Recognition of DNAs and RNAs wide range of biological actions has driven modern biopharmaceutical research into the therapeutic value of oligonucleotides.
Moritz Wagner, Zoltan Timar, Edgar Naegele, and Gordon Ross, Agilent Technologies
Recognition of DNAs and RNAs wide range of biological actions has driven modern biopharmaceutical research into the therapeutic value of oligonucleotides. They are prepared by chemical synthesis and while their size and biological function vary, the requirement for their quality control is the same. The quality control of synthetic oligonucleotides requires a high resolution chromatographic method in order to separate the desired oligonucleotide from fragments generated as a consequence of the automated synthesis and post synthetic process. Liquid chromatography coupled to UV and MS detection allows both relative quantification of the main component and its impurities (UV) and their identification via accurate mass determination (MS).
Figure 1: Detection of a synthetic oligonucleotide and its byproducts with a DAD at 259 nm, 2 µg on-column. The annotations show both the peak area percent and base sequence.
The main component, together with its by-products, was detected by UV absorbance at 259 nm. Impurities could be determined down to 0.2% (Figure 1). The base sequences were identified from their accurate mass as discussed below and is annotated. Figure 2 demonstrates that the UV (259 nm) response was linear over the range 160 pg/µL to 100 ng/µL (3.2 ng to 2 µg on-column) and the LLOQ was 160 pg/µL with S/N = 13. This was sufficient to provide quantification of the desired oligonucleotide.
Figure 2: Calibration curve of full length product (FLP) (UV 259 nm) (Insert: response obtained for the LLOQ 160 pg/µL).
The Full Length Product (FLP): 5'-d(GTGTCAGTAC-AGATGAGGCCT)-3', elutes at 8.6–8.8 min and different charge states can be detected. The calculated average mass using maximum entropy deconvolution was 6486.28 (Figure 3) and the monoisotopic mass calculated by resolved isotope deconvolution was 6483.108. It was possible to confirm the mass of the main product and to assign the impurities as shown in Figure 1.
Figure 3: Maximum Entropy deconvoluted mass spectrum of FLP 5'- d(GTGTCAGTACAGATGAGGCCT)-3', calculated average mass 6486.203 a.m.u.
This application demonstrates the separation of a crude synthetic oligonucleotide mixture after synthesis and final cleavage from the solid support. The Agilent 1290 Infinity LC System coupled with the Agilent 6530 Accurate-Mass QTOF-MS System can be used to simultaneously quantify and identify impurities down to lower nanogram levels and relative levels of 0.2% of the main compound. While UV detection allows quantification down to an LLOQ of 3.2 ng on-column, the accurate mass measurement allows the highly accurate determination of the average and monoisotopic mass and the base sequence of the synthesized oligonucleotide and process-related impurities.
Agilent Technologies
2850 Centerville Road, WIlmington, DE 19808
tel. (800) 227-9770, fax (302) 633-8901
Website: www.agilent.com
Trends, Best Practices, and Analytical Challenges in Chemical Characterization of Medical Devices
October 7th 2024Chemical characterization of medical devices, including drug-device combination products, is crucial for ensuring regulatory compliance and patient safety by identifying and quantifying chemicals that may interact with the human body. This paper explores current trends, best practices, and regulatory developments in extractables and leachables (E&L) testing for medical devices.
Pick Your Poison: Isolation of Paclitaxel (Octt 2024)
October 4th 2024The diterpenoid, paclitaxel, which was identified as a potent chemotherapy agent for breast and ovarian cancer originates from the Pacific Yew tree. The isolation of paclitaxel from its major impurities is shown with the use of Hamilton’s PRP-1 (5 µm) HPLC column.